H and I, Quantitative polymerase chain reaction analysis of cell migratory gene expression, including Mmp9 and PlexinD1 using RNA isolated from iHA-Etv2 MEFs in the absence (Dox) or presence (+Dox) of doxycycline for 24 h. Note increased expression of these genes in the Dox-treated samples compared with Dox (n=3 replicates; **P<0.01). 1 and No. Feedback mechanisms regulate Ets variant 2 (Etv2) gene expression and hematoendothelial lineages. After transduction of ETV2, fibroblasts were cultured on type I collagen-coated dishes in EGM-2 medium supplemented with 10 ng/ml VEGF and bFGF. D, qPCR analysis for Rhoj transcripts using the E8.5 Etv2 WT and null embryos. Singh, J.E. (A) Expression levels of FOXC genes in HAFs. government site. (C) Absolute numbers of ETVECs. Clipboard, Search History, and several other advanced features are temporarily unavailable. 2020;40:28752890. Based on these results, we proposed that ETV2 was an important regulator of Rhoj in endothelial progenitors. Figure 1.. Etv transcription factors are controlled by FGF-ERK signaling in the lens. No doxycycline and no VEGF were used as controls in these experiments. Unauthorized Thus, creating ECs from nonvascular cells by transducing some transcription factors not only leads to the development of new strategies for patient-specific therapeutic angiogenesis, but also facilitates the maintenance of the solid organs that are regenerated from pluripotent stem cells. The levels of Rhoj transcripts were significantly reduced in the Etv2 null EBs (n=3 replicates; **P<0.01). Fluorescence was detected using an Odyssey CLx imager (LI-COR Biosciences, Lincoln, NE). HFL-ECs expressed ERG and FLI1 at significantly higher levels than ETVECs (SI Appendix, Fig. MeSH Moreover, COL1A2 was significantly down-regulated in this population (Fig. Etv2 is a master regulator of hematoendothelial lineages. In the present study, we showed that the overexpression of ETV2 resulted in 90-fold increase in Rhoj-promoter-reporter luciferase activity. The https:// ensures that you are connecting to the These results further supported the notion that ETV2 regulates migration through the regulation of Rhoj expression. Doxycycline (1 g/mL) was added to iHA-Etv2 MEFs for migration assays and transcriptional analysis. Epub 2002 Oct 18. E, qPCR analysis for Rhoj transcripts using RNA from uninduced (Dox) and induced (+Dox) iHA-Etv2 mouse embryonic fibroblasts (MEFs). Each EC subset is known to express specific markers (18, 19). Furthermore, addition of an ETV2 specific antibody to this protein-DNA complex supershifted (asterisk) the complex formation, but this supershift was not observed when using a denatured (heat-inactivated; h.i.) Our study demonstrates that stable ETV2 expression induces numerous endothelial-specific genes other than those evidently regulated by the FOX:ETS motif from human fibroblasts. 3 WT Strand18 unlabeled: AACCCACGATTTCCTGACACTCGGC; Site No. Mech Dev. This site needs JavaScript to work properly. Bethesda, MD 20894, Web Policies An intriguing explanation for this finding is that laminar shear stress and/or angiopoietin-1 produced by -SMA+ mural cells may induce eNOS expression in the ETVECs (25, 33). Note the increased expression of cell migration genes following the overexpression of HA (hemmagglutinin)-ETV2 at both 6 and 12 h time points. 2022 May;24(5):672-684. doi: 10.1038/s41556-022-00901-3. and A.Y. Taken together, these results demonstrate that ETV2 alone directly induces ECs from human fibroblasts. We also observed that the overexpression of ETV2 led to increased cell migration in both EBs and MEFs. In summary, we defined a novel role for ETV2 in the regulation of cell migration and showed that ETV2 is a direct upstream activator of Rhoj gene expression and together this cascade regulates hematoendothelial progenitor cell migration. 4 BD). (BD) Fifteen days later, Venus+ cells were subjected to quantitative RT-PCR analysis (B) and flow cytometry analysis (C and D). iPSCs are an especially promising source for creating ECs, although the main limitation of applying iPSCs is the risk of incomplete differentiation and tumorigenicity (4, 5). 1 WT Strand (bottom) unlabeled: GCTGTCAAACTTCCTGCTTTATCCC; Site No. At 15 d after the infection of HAFs with these lentiviruses, EC induction was evaluated by flow cytometry analysis. S1E). RNAseq, chromatin immunoprecipitation (ChIP)-seq, and assay for transposase accessible chromatin (ATAC)-seq analyses showed enrichment of cell migration program following the overexpression of ETV2 (Ets variant transcription factor 2) in the embryonic stem cell (ESC)/embryoid body (EB) system.A, Heatmap analysis of bulk RNAseq datasets using iHA-Etv2 ES/EBs showing increased expression of cell migration genes (gene ontology [GO]:0048870) in doxycycline (Dox)-induced EBs relative to uninduced EBs. Nature 585, 426432 (2020). However, we found that optimal ETV2 expression levels were essential for converting human fibroblasts into ETVECs; lower or higher ETV2 expression failed to surmount the fibroblastic state. It is commonly thought that these transcription factors faithfully follow the instructions they receive from the external signal: for instance, if the message was to encourage the cell to grow, the transcription factors would switch on growth-related genes. A histone demethylase, Jmjd1a, has been shown to suppress ETV2 to activate transcription from the matrix metalloproteinase-1 promoter by directly interacting with ETV2 (21, 32). All methods were performed in accordance with the relevant guidelines and regulations. To do so, we infected the human embryonic lung fibroblast cell line HFL-1 with a pool of 18 TF lentiviruses. Bethesda, MD 20894, Web Policies Significance was determined by 1-way ANOVA with multiple comparison. D, Quantification of ESC migration. Data are representative of three independent experiments. Global gene expression analysis revealed that ETVECs clustered with HUVECs rather than with their HAFs of origin, as illustrated by hierarchal clustering (Fig. To clarify the relationship between the intensity of ETV2 expression in HAFs and EC induction from HAFs, we regulated ETV2 expression levels in HAFs using a doxycycline (Dox)-inducible system. Mol. Although many attempts have been made to generate ECs from pluripotent stem cells and nonvascular cells, the minimum number of transcription factors that specialize in directly inducing vascular ECs remains undefined. S2D). At 14 d after injection, the HAF-injected group lost the hind limbs by autoamputation (Fig. Transcriptional control of endothelial cell development. These results revealed the functional divergence between Etv and FGF in lens development, demonstrating that these SRTFs can operate outside the confine of their upstream signaling. D and E, The biological process and pathways that are significantly enriched in the upregulated genes following ETV2 overexpression in the ESC/EB system. Top-strand, WT oligonucleotides were synthesized with and without the IRDye 700 fluorophore (Integrated DNA Technologies, Coralville, IA). 2021 Jun 30;7(27):eabf1068. Data are representative of three independent cell cultures. In this paper, we show that the single transcription factor ETV2, which is lentivirally transduced, induces expression of the multiple EC-specific molecules in coordination with endogenous FOXC2 in the fibroblasts, resulting in the conversion of primary human adult skin fibroblasts into functional ECs that form mature perfused vessels in vivo. An official website of the United States government. 2011;366:12501264. Thus, we consider HOPX to be incidentally expressed in HFL-ECs. 2022. Federal government websites often end in .gov or .mil. Notch signaling is required for lateral induction of Jagged1 during FGF-induced lens fiber differentiation. Cathepsin L is required for endothelial progenitor cell-induced neovascularization. Epub 2009 May 27. Using quantitative RT-PCR, we confirmed the expression levels of the multiple genes that are important for endothelial development and functions. In this paper, we show that the single transcription factor ETV2, which is lentivirally transduced, induces expression of the multiple EC-specific molecules in The transcriptional assays were undertaken using our previously published protocols.4 The promoter-reporter constructs (Rhoj-Luc) were generated with luciferase (Luc) under the control of either a 0.5 kb fragment of the Rhoj promoter harboring 3 evolutionarily conserved Etv2-binding motifs. Conclusions: Curr Top Dev Biol. The beads were then washed 5 with cold RIPA wash buffer (1% Triton X-100, 150 mmol/L NaCl, 0.1% SDS, 1 mmol/L EDTA, 50 mmol/L Tris-HCl [pH 8], 0.5% Na-Deoxycholate), and then TE buffer. Persistent nuclei in. F30 HL152561/HL/NHLBI NIH HHS/United States, R01 HL144582/HL/NHLBI NIH HHS/United States, Ye, L., Zimmermann, W.-H., Garry, D. J. Arterioscler Thromb Vasc Biol. According to the Venus (ETV2) and VEGF-R2 expression, at day 14, the ETV2-transduced HAFs consisted of four distinct populations (Fig. Basic and Translational Research in Cardiac Repair and Regeneration: JACCState-of-the-ArtReview. (A) At 14 d after culture, Venus+ cells were subjected to quantitative RT-PCR. Etv2 transcriptionally regulates Yes1 and promotes cell proliferation during embryogenesis. Fibrosis in the lens. 2022;45(4):483-490. doi: 10.1248/bpb.b21-00929. (AF) Images of Matrigel plugs extracted from NOD SCID mice 28 (AD and F) and 42 (E) days after the implantation of ETVECs (AF) and HAFs (A). ETV2 was originally found to regulate vascular development and angiogenesis at the embryonic phase (13). Print 2022 May. WebRecent findings We recently demonstrated that the ETS transcription factor Etv2, a critical factor for haematopoietic and vascular development, is also required for haematopoietic Inhibition of BMP signaling during zebrafish fin regeneration disrupts fin growth and scleroblasts differentiation and function. The ETS Factor, ETV2: a Master Regulator for Vascular Endothelial Cell Development. Induction of hematopoietic and endothelial cell program orchestrated by ETS transcription factor ER71/ETV2. Mol Cells. WebThe ETS transcription factors, consisting of pattern, these ETS factors have shown to be essential approximately 28 members, are involved in diverse for the establishment and The Author(s), under exclusive licence to Springer Nature Limited. 1 and No. 2017 Mar 3;120(5):848-861. doi: 10.1161/CIRCRESAHA.116.309833. Many EC phenotype-representative genes, including ESMA and SCARF1, were highly enriched, and the fibroblast markers TWIST2 and ZEB2 were down-regulated in ETVECs (SI Appendix, Fig. Epub 2015 Dec 21. ( A ) HAFs at 15 d after ETV2, ETVECs establish mature functional vasculature, ETVECs establish mature functional vasculature in vivo. Nam D, Park MR, Lee H, Bae SC, Gerovska D, Arazo-Bravo MJ, Zaehres H, Schler HR, Kim JB. S4B). It has been previously reported that the expression of ETV2 is absent in ESCs and is transient in differentiating EBs, with the highest expression between D3 and D4 of EB differentiation.4,15,23 To examine the role of ETV2 in cell migration, we plated iHA-Etv2 ESCs in a monolayer and performed scratch assays in the absence (Dox) or presence (+Dox) of doxycycline. 2, and Site No. Analyzing the expression pattern of the EC subset markers revealed that ETVECs had venous EC properties. Local Info Induced Endothelial Cell-Integrated Liver Assembloids Promote Hepatic Maturation and Therapeutic Effect on Cholestatic Liver Fibrosis. Fli1 and Erg are downstream targets of ETV2 and contribute to hemato-endothelial lineage development.32,33 Because of the transient expression of ETV2 during embryogenesis,15 it is possible that ETV2 initiates the migration process in the angioblast populations and subsequently, other Ets-factors including Fli1 and Erg maintain cellular migration in the mature endothelial population at later stages of developments as well as postnatally. 2021 Nov 23;78(21):2092-2105. doi: 10.1016/j.jacc.2021.09.019. Shi X, Richard J, Zirbes KM, Gong W, Lin G, Kyba M, Thomson JA, Koyano-Nakagawa N, Garry DJ. Endothelial cell origin and migration in embryonic heart and cranial blood vessel development. 1 A, F, and G). (H) Hematoxylin and eosin staining of the adductor muscles of ischemic limbs. Similarly, rescue experiments using another shRNA construct (No. -, Carbe C, Garg A, Cai Z, Li H, Powers A, Zhang X. etv2. See this image and copyright information in PMC. Note a significant enrichment of Rhoj in the Flk1+/Pdgfra (lateral plate mesoderm) cells relative to the other lineages (n=3 replicates; **P<0.01). cDNA (complementary DNA) was synthesized using the SuperScript IV VILO kit (Thermo Fisher Scientific) according to the manufacturers protocol. Significance was determined by 1-way ANOVA with multiple comparison. ChIP assay for the Gapdh promoter was used as a control. Significance was determined by Student t test with 2-tailed distribution and equal variance (B) and 1-way ANOVA with multiple comparison (E). G, Quantification of iHA-Etv2 MEFs migration in the Dox and +Dox conditions. ER71/ETV2; FLK1/VEGFR2; angiogenesis; cardiovascular; direct cell reprogramming. The y axis (% Hits) indicates the percent of upregulated genes that have the annotation of corresponding GO terms. Epub 2015 Nov 19. ETVECs expressed a series of endothelial effector molecules including a mature endothelial marker, von Willebrand factor (vWF), at both mRNA and protein levels (23), but lacked COL1A2 and surface CD45 expression (Fig. Our analysis showed a relatively robust and restricted enrichment of Rhoj in the Flk1+/Pdgfra population as compared with other lineages (Figure 3H; n=3 replicates; **P<0.01). Thus, ETVECs may obtain further maturity in the appropriate tissue microenvironment to establish stable and long-lasting vasculature. Would you like email updates of new search results? Front Cell Dev Biol. This study was supported by the Ministry of Education, Culture, Sports, Science and Technology of Japan; the Japan Society for the Promotion of Science [Grant-in-Aid for Scientific Research A 22249009 (to A.Y. An official website of the United States government. 4, supporting the importance of endogenous FOXCs in converting human fibroblasts into ECs by transducing ETV2. To investigate whether ETV2 transcriptionally activates these genes, we analyzed publicly available ETV2 ChIP-seq datasets during ESC/EB differentiation.22 We examined the promoter regions of genes (transcription start site [TSS]5 kb) for ETV2 ChIP-seq peaks and found ETV2-binding sites in the promoters of 5195 genes. FOIA The regulatory mechanisms that govern their migration are not completely defined. To determine which ETV2 domain is essential for the EC induction, we constructed four types of HA-tagged ETV2 truncations for lentivirus vectors (SI Appendix, Fig. Cardiovasc Res. Expression analysis shows that etv2 is highly expressed in hematopoietic and endothelial precursor cells in the Xenopus embryo. We then utilized ATAC-seq datasets5 from differentiating iHA-Etv2 ESCs/EBs and found an ATAC-seq peak and ChIP-seq peak in the +Dox condition compared with Dox controls (Figure 4A). 2). Unable to load your collection due to an error, Unable to load your delegates due to an error. ETS Transcription Factor ETV2/ER71/Etsrp in Hematopoietic and Vascular Development. (C) Photos of the two representative EC colonies at 20 d after the culture with or without Dox. Pioneer transcription factors in cell reprogramming. S1E). Transdifferentiation of fast skeletal muscle into functional endothelium in vivo by transcription factor Etv2. (A) HAFs at 15 d after ETV2 infection were subjected to flow cytometry analysis. In coordination with endogenous FOXC2 in fibroblasts, transduced ETV2 elicits expression of multiple key endothelial development factors, including FLI1, ERG, and TAL1, and induces expression of endothelial functional molecules, including EGFL7 and von Willebrand factor. ETV2 is a direct upstream regulator of Rhoj and the ETV2-Rhoj cascade regulates endothelial progenitor cell migration. Consequently, ETVECs exhibits EC characteristics in vitro and forms mature functional vasculature in Matrigel plugs transplanted in NOD SCID mice. S3 A and B). Figure 5figure supplement 1.. Fgf3 overexpression stimulates expressions of Etv and Spry in the lens. The Rhoj promoter region was amplified using PCR and subcloned into the pGL3 vector to generate pGL3-Rhoj-Luc. Cells. Initially, we clustered our published bulk RNAseq datasets7 based on the following criteria: (1) up- or downregulated by >1.5 fold difference between Dox and +Dox conditions; (2) significant differential expression (P<0.05); (3) location of ETV2-binding motifs in the up/downstream regions of their transcriptional start site; and (4) annotation using the GO-classification for cell migration. Generation of functional hemangioblasts from human embryonic stem cells. The complimentary WT or mutant oligos were annealed to generate labeled probe and unlabeled competitor DNA. Pioneer transcription factors, chromatin dynamics, and cell fate control. Our results indicated that Rhoj transcripts were robustly expressed in the zsGreen+ cell populations compared with zsGreen cells at D3 and D4 of differentiation (Figure 3F; n=3 replicates; *P<0.05). All authors approved the article. Han JK, Chang SH, Cho HJ, Choi SB, Ahn HS, Lee J, Jeong H, Youn SW, Lee HJ, Kwon YW, Cho HJ, Oh BH, Oettgen P, Park YB, Kim HS. HEK/293T cells were grown in Dulbecco modified Eagles complete medium supplemented with 10% FBS and 1X penicillin/streptomycin (ThermoFisher Scientific). Epub 2015 Mar 23. Cell Stem Cell. In addition, the generation of ECs has become increasingly important for providing vascular plexus to regenerated organs, such as the liver. (J) Comparison of perfusion recovery in ischemic hind limbs. ECs and hematopoietic cells both originate from a common precursor, the hemogenic endothelium, which is present in the yolk sac, the aorta-gonad-mesonephros region, and the placenta (12). In addition, ETV2 alone also induced CD31+ cells from not only the human neonatal skin fibroblast cell line NB1RGB, but also primary human adult skin fibroblasts (HAFs) (SI Appendix, Figs. Curr Opin Genet Dev. doi: 10.26508/lsa.202201369. We demonstrate that ETV2 upregulates cellular migratory networks by binding to and enhancing chromatin accessibility of genes that govern cell migration. ETS transcription factor Etv2, a critical factor for haematopoietic and vascular development, is also required for haematopoietic regeneration. De Val S, et al. Endothelial precursor cell migration during vasculogenesis. ETV2 (ETS variant transcription factor 2) 2007-04-01 Identity HGNC ETV2 LOCATION 19q13.12 LOCUSID 2116 ALIAS ER71, ETSRP71 Non-annotated gene. The role of RhoJ in endothelial cell biology and tumor pathology. To further confirm these migratory results, we undertook qPCR analysis using RNA isolated from migrating iHA-Etv2 MEFs in the presence or absence of doxycycline. C, Rhoj has a similar expression pattern to (B) endogenous Etv2 and (D) endothelial marker Emcn. 6 A and B). J Clin Invest. 1 C and D), indicated in blue and black lines, respectively, in Fig. Gene expression levels relative to HPRT1 (mean SD; triplicate). In the other primer pair, the forward primers were designed for each target and the reverse primer was shared [SI Appendix, Fig. Collectively, these results will serve as a platform for the development of therapeutic initiatives directed towards cardiovascular diseases and solid tumours. Disclaimer, National Library of Medicine Nat Cell Biol. HHS Vulnerability Disclosure, Help Our study demonstrates that the ETS factor ETV2 is sufficient to induce expression of multiple key endothelial development factors, including FLI1 and ERG, in human fibroblasts; consequently, ETV2-expressing fibroblasts convert into functional ECs. Direct conversion of fibroblasts to functional neurons by defined factors. 2022 Sep;52(9):643-658. doi: 10.4070/kcj.2022.0190. Print 2021 Jun. Single-cell RNAseq analysis of Etv2-EYFP+ sorted cells revealed coexpression of Etv2 and Rhoj in endothelial progenitors at E7.75 and E8.25. Figure 6.. Etv induces Jag1 expression to control Notch signaling. WebRecently, the ETS transcription factor, ETV2 (also known as ER71), has been recognized as a master regulator of the development of the cardiovascular system and plays an important The signal regulated transcription factors (SRTFs) control the ultimate transcriptional output of signaling pathways. 2013;288:1213012141. ( A F ) Images, MeSH Cardiovascular diseases have long been the leading cause of mortality and morbidity in the United States as well as worldwide. An official website of the United States government. Additional emphasis should be given to identification of novel pathways in migration as well as the promotion of the Etv2-Rhoj network in the context of ischemia or the repression of the Etv2-Rhoj network in the context of tumor vascular biology and angiogenesis, as both of these factors have been shown to play a role in cancer.12,3436. Accessibility 6H). Data are mean SD (PBS, n = 10; HAFs, n = 10; ETVECs, n = 6). The .gov means its official. All buffers were supplemented with a protease inhibitor cocktail (Sigma P8340). Sci. Generation and Application of Directly Reprogrammed Endothelial Cells. E, Western blot analysis of exogenous ETV2 using an anti-HA antibody with cell lysate from Dox and +Dox treated iHA-Etv2 mouse embryonic fibroblasts (MEFs). YAP regulates cell proliferation, migration, and steroidogenesis in adult granulosa cell tumors. Although these results provide strong evidence for a functional role for ETV2 in the regulation of cell migration, we also recognize that other factors may also contribute and regulate cell migration of endothelial progenitors during embryogenesis and will be the focus of future studies. Bookshelf See this image and copyright information in PMC. To evaluate the angiogenic potential of ETVECs in vivo, we implanted Matrigel-suspended ETVECs and HAFs s.c. into NOD SCID mice. Notably, we found that this migratory defect because of Rhoj knockdown was partially rescued by overexpression of ETV2 in iHA-Etv2 MEFs (Figure 6A and 6B; compare [4] and [8] in Figure 6A; n=3 replicates; **P<0.01). Unable to load your collection due to an error, Unable to load your delegates due to an error. We found that cell migration genes (GO-classification for cell migration [GO: 0048870] genes) have higher ETV2 ChIP-seq peaks near their TSS region than nonmigration genes (335 out of 1543 genes, Fisher exact test P<0.001; Figure 1B). DNA was purified with the PCR purification kit (Qiagen), and qPCR was performed using specific primers. Lee S, Park C, Han JW, Kim JY, Cho K, Kim EJ, Kim S, Lee SJ, Oh SY, Tanaka Y, Park IH, An HJ, Shin CM, Sharma S, Yoon YS. The functional role of the meis/Prep-binding elements in Pax6 locus during pancreas and eye development. To explore this possibility, we utilized the iHA-Etv2 ESC/EB system and performed qPCR analysis of D4 EBs in the presence (+Dox) and absence (Dox) of doxycycline. MeSH S1A). Zhang H, Yamaguchi T, Kokubu Y, Kawabata K. Biol Pharm Bull. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. (B) Purifying ETVECs through sorting CD31+ cells. Unable to load your collection due to an error, Unable to load your delegates due to an error, ETVECs establish mature functional vasculature in vivo. Figure 3figure supplement 1.. RNA sequencing analysis identified Etv-regulated genes. Here, by screening 18 transcription factors that are important for both endothelial and hematopoietic development, we demonstrate that ets variant 2 (ETV2) [1] In the field of molecular biology, the ETS ( E26 transformation-specific [2] or E-twenty-six. The .gov means its official. More importantly, it hardly induces ECs from human adult fibroblasts (8), which are readily accessible EC materials for facilitating autologous therapeutic angiogenesis. 1H). In this review, we highlight the role of Etv2 in the Note a significant enrichment of Rhoj in zsGreen+ cells relative to zsGreen cells (n=3 replicates; *P<0.05). The site is secure. iHA-Etv2 MEFs were used for chromatin immunoprecipitation (ChIP) using the protocol as previously described.5 Briefly, MEFs were dissociated into single cells using 0.25% trypsin, fixed with 1% formaldehyde at room temperature for 10 minutes, and quenched in 0.125 mol/L glycine. We then analyzed ETV2 chromatin immunoprecipitation-seq and assay for transposase accessible chromatin-seq datasets, which showed enrichment of chromatin immunoprecipitation-seq peaks with increased chromatin accessibility in migratory genes following overexpression of ETV2. 2022 Jan;12(1):210265. doi: 10.1098/rsob.210265. government site. Recently, the ETS transcription factor, ETV2 (also known as ER71), has been recognized as a master regulator of the development of the cardiovascular system and The ETS-related transcription factor 2 (ETV2) is a transcription factor that is both necessary and sufficient for the development of endothelial and blood lineages. Epub 2016 Feb 12. 2003 Jan 3;278(1):537-44. doi: 10.1074/jbc.M208380200. (A, B, F, and G) Flow cytometry analysis. Taken together, these findings indicate that ETV2 is a core factor for directly converting somatic cells into ECs. Disclaimer, National Library of Medicine Revolutionizing cardiovascular medicine: targeted therapies for the cardiac conduction system. Non-annotated gene. An official website of the United States government. Overexpression of ETV2 led to a robust increase in Rhoj in both embryoid bodies and mouse embryonic fibroblasts, whereas, its expression was abolished in the Etv2 knockout embryoid bodies. HHS Vulnerability Disclosure, Help Epub 2016 Dec 21. Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Analysis of sprout formation at day 3 and day 6 of plating showed 10% of EBs with sprout formation in the Dox condition. First, we identified the role of ETV2 in the regulation of cell migratory networks. Epub 2014 Feb 26. At 28 d after implantation, ETVECs, but not HAFs, formed vasculature that was recognized not only by a human CD34-specific mAb, but also by Ulexeuropaeus agglutinin I (UEA I) that binds to human, but not murine, ECs (1, 24) (Fig. Data are representative of 10 independent cell cultures (B) or four independent cell cultures (A, C, and FK). Significance was determined by 1-way ANOVA with multiple comparison. ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage. S1D). S1 F and G), we conclude that the Venus+CD31+ HFL-1 cells are ECs (HFL-ECs). This site uses cookies. Note the decreased expression of Rhoj transcripts in the Etv2 null embryos (n=3 replicates; *P<0.05). To further evaluate the role of ETV2 in angioblasts, we investigated and mined our previously published RNAseq datasets,7 obtained from differentiating ESCs and EBs following doxycycline-induced (+Dox) overexpression of ETV2 (iHA-Etv2-ESCs) for 6- or 12-hour periods on day 3 (D3) of differentiation. Mechanistically, we showed that ETV2 binds the promoter region of Rhoj serving as an upstream regulator of cell migration. ( A ) Expression, ETVECs represent proliferative ECs. After binding to the FOX:ETS motif, ETV2 is thought to recruit cofactors to induce posttranscriptional modifications to ETV2 and/or alter DNA methylation states of the endothelial genes, resulting in facilitation of endothelial gene expression (31). Armulik A, Genov G, Betsholtz C. Pericytes: Developmental, physiological, and pathological perspectives, problems, and promises. Combinatorial regulation of endothelial gene expression by ets and forkhead transcription factors. Migratory assays showed that overexpression of ETV2 enhanced cell migration in mouse embryonic stem cells, embryoid bodies, and mouse embryonic fibroblasts. Mesodermal progenitor marker T (Brachyury) and multiple endothelial development factors (ERG, FLI1, FOXC2, GATA2, TAL1, and VEZF1) (Fig. Life Sci. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. Furthermore, we show that ETV2 acts as an upstream regulator of Rhoj and regulates its expression in endothelial progenitors. Data are presented as meanSEM. 8600 Rockville Pike Vierbuchen T, Wernig M. Direct lineage conversions: Unnatural but useful? -, Wang, K. et al. Correspondence to: Daniel J. Garry, MD, PhD, Lillehei Heart Institute, 2231 6th St SE, (CCRB 4-146), University of Minnesota, Minneapolis, MN 55455. S1C). ETVECs, but not HAFs, developed human CD34+ blood vessels in the muscles of the ischemic limbs (Fig. Following doxycycline treatment, 30 to 50 day, 3 EBs were transferred to a 12-well plate coated with low growth factor matrigel and supplemented with 50 ng/mL of VEGF (vascular endothelial growth factor) in serum free media. RHOJ, a member of the Rho GTPase subfamily, is highly expressed in endothelial cells and is required for focal adhesion numbers and actomyosin contractility.12 Several studies have demonstrated that RHOJ interacts with the GIT-PIX complex to regulate focal adhesion disassembly in endothelial cells.9 Furthermore, RHOJ has been shown to regulate the activity of CDC42 and RAC1 during lamellipodia formation.13 The knockout of Rhoj results in delayed radial growth and defective vascular structures.9 Similarly, the conditional knockout of Rhoj in the endothelial lineage results in reduced growth and abnormal vascular development at E10.5.14 These studies support an important role for RHOJ in endothelial lineages, but the mechanisms regulating RHOJ expression in the endothelial lineage is unclear. PMC doi: 10.4161/auto.28768. Next, we directly tested whether the overexpression of ETV2 could induce cell migration in an in vitro setting. Samples were centrifuged and resuspended in 1.5 mL lysis buffer 3 (0.5% N-Laurylsarcosine, 0.1% Na-Deoxycholate, 0.5 mmol/L EGTA, 1 mmol/L EDTA, 100 mmol/L NaCl, 10 mmol/L Tris-HCl [pH 8]), followed by sonication to achieve 200 to 500 basepair (bp) DNA fragments using an ultrasonicator. Inthis study, by screening 18 transcription factors, including the ETS family factors, we demonstrate that the single ETS factor ETV2 is sufficient for directly converting primary human adult skin fibroblasts into functional ECs (ETVECs). Urbich C, et al. S11). Stem Cells. Epub 2022 Jan 12. Induction of ETV2 showed increased migration of MEFs compared with controls (Dox; Figure 6A and 6B; compare [2] and [6] in Figure 6A; n=3 replicates; **P<0.01). Sema3E-PlexinD1 signaling selectively suppresses disoriented angiogenesis in ischemic retinopathy in mice. CD31hi cells were sorted again, then cultured for an additional 10 d under the same culture conditions. Vascularized and functional human liver from an iPSC-derived organ bud transplant. This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1413234112/-/DCSupplemental. Dox-inducible ETV2 and rtTA-transduced HAFs were cultured in the presence of various Dox concentrations. Regulation of endothelial cell differentiation and specification. G, Fluorescent-activated cell sorting (FACS) profile of mesodermal derivatives using a wild-type ESC/EB system. Preliminary data : if you are an author who wish to write a full paper/card on this gene, contribute in submission tool. FOIA A possible connection between reactive oxygen species and the unfolded protein response in lens development: From insight to foresight. AG, AH, QW, NM, JZ, HL, SY, YM, XZ No competing interests declared, Figure 1.. Etv transcription factors are controlled. The list of taqman probes used is provided in Table III in the Data Supplement. WebThe accumulative data indicate that ETV2, an ETS transcription factor, performs a potent and indispensable function in mediating vessel development. Lammerts van Bueren K, Black BL. Our study indicates that human fibroblasts express substantial levels of endogenous FOXC2 under steady-state conditions, and that knockdown of FOXC2 in human fibroblasts results in loss of ETVEC generation, which clearly explains why transducing only ETV2 into human fibroblasts was sufficient to convert the fibroblasts into ETVECs. H, qPCR analysis for Rhoj transcripts from Flk1/Pdgfra (other lineages), Flk1+/Pdgfra (lateral plate mesoderm), Flk1+/Pdgfra+ (cardiac mesoderm), and Flk1/Pdgfra+ (paraxial mesoderm) sorted cells using the wild-type (WT) ES/EB system. Here we report that ETV2 functions as a pioneer factor that relaxes closed chromatin and regulates endothelial development. The percentage of CD31+ cells in each population is shown in F and G. (C and H) Quantitative RT-PCR. Imaging and quantification of the distance migrated revealed that the overexpression of ETV2 resulted in increased migration of ESCs compared with control (Figure 2D; n=4 replicates; *P<0.05). The ETVEC-constituting vessels also expressed VE-cadherin (Fig. Dev Biol. The membrane was subsequently incubated with anti-rabbit (Santa Cruz Biotechnology [SC-2004; 1:2000]) or anti-mouse (Santa Cruz Biotechnology [SC-2005; 1:2000]) HRP (horseradish peroxidase)-conjugated secondary antibody and visualized using the Pico luminescence kit (Invitrogen) according to the manufacturers instructions. Etv2 is known to require its combination with FoxC for vascular gene expression in Xenopus and zebrafish embryos (13, 22), evoking the possibility of FOXC involvement in ETVEC induction. Bottom: chromatin immunoprecipitation (ChIP) analysis of doxycycline (Dox)-inducible iHA-Etv2 mouse embryonic fibroblasts using an HA antibody (n=3 replicates; **P<0.01). Figure 4.. Data are presented as meanSEM. Genes & Development. -. (B) Blue and red bars indicate FOXC2 and control shRNA, respectively. These results indicated that ETV2 could promote migratory processes during differentiation by transcriptionally activating and relaxing the chromatin near the TSS of endothelial genes. In coordination with endogenous FOXC2 in fibroblasts, transduced ETV2 elicits expression of multiple key endothelial development factors, including FLI1, ERG, Genes Dev. 8600 Rockville Pike S9). S2 B and C). -, Hollenhorst PC, Jones DA, Graves BJ. Gene expression levels are relative to HPRT1 (mean SD; triplicate). official website and that any information you provide is encrypted Mol Cells. For the hind-limb ischemic model, cells or PBS were injected into the adductor muscle of the ischemic thigh. These results suggest that VEGF and bFGF supplementation improves both the efficiency of the direct conversion of ETV2-transduced HAFs to ETVECs and the proliferation of ETVECs. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. Cells were harvested 36 hours after transfection and luciferase activity quantified using the Dual Luciferase Stop-Glo System (Promega). The https:// ensures that you are connecting to the 1], Figure 5D [site No. In the Flk1+/Pdgfra sorted cells, we found Etv2 to be highly expressed (Figure 3I; n=3 replicates; *P<0.05). doi: 10.1101/gad.184000. Vascular ECs are classified into three subsets according to the objective of their development: venous, arterial, and lymphatic ECs. Data are mean SD. The Journal of Biological Chemistry. 2116. B, Luciferase reporter constructs using the Rhoj promoter (0.5 kb) harboring wild-type (WT; wt; open box) or mutant (mut; crossed box) ETV2-binding motifs. 8600 Rockville Pike Department of Medicine, Lillehei Heart Institute (B.N.S., J.E.S.-P., W.G., S.D., J.W.M.T., E.S., M.G.G., D.J.G. S2A (C) and Tables S1 and S2]. 8600 Rockville Pike Here, we describe a novel role for ETV2 (Ets variant transcription factor 2) in cell migration and provide evidence for an ETV2-Rhoj network as a mechanism responsible for this process. HHS Vulnerability Disclosure, Help We then utilized the 3.9 kb Etv2 promoter driving zsGreen-DR (Etv2-zsGreen1-DR) ESC/EB system23 and sorted zsGreen and zsGreen+ cells at D3 and D4 of differentiation and performed qPCR for Rhoj. 2016;118:77-111. doi: 10.1016/bs.ctdb.2016.01.005. eCollection 2022. Lacrimal gland budding requires PI3K-dependent suppression of EGF signaling. The ETS transcription factor Etv2 has proven to be essential for hematopoietic and vascular development. 1 A and B). D, Schematic showing the ETV2-RHOJ network in the regulation of cell migration. LOCUSID. (Scale bars: 50 m.). Careers. Red and blue lines indicate targets and isotype controls, respectively. Gene expression levels are relative to HPRT1. Shrestha S, Lamattina A, Pacheco-Rodriguez G, Ng J, Liu X, Sonawane A, Imani J, Qiu W, Kosmas K, Louis P, Hentschel A, Steagall WK, Onishi R, Christou H, Henske EP, Glass K, Perrella MA, Moss J, Tantisira K, El-Chemaly S. Life Sci Alliance. ETV2 (Ets variant transcription factor 2) promotes cell migration by inducing migratory networks in differentiating embryoid bodies, mouse angioblasts, and mouse embryonic fibroblasts. Circ. The stability of the lens-specific Maf protein is regulated by fibroblast growth factor (FGF)/ERK signaling in lens fiber differentiation. Approach and Results: Analysis of RNAseq datasets showed robust enrichment of migratory/motility pathways following overexpression of ETV2 during mesodermal differentiation. Prebinding reactions included 5 nmol of unlabeled competitor oligo as appropriate. Nearly all of the ETVEC-constituting vessels allowed erythrocyte circulation through the vessels (Fig. Careers. ALIAS. Contrary to FGF receptor mutants that displayed loss of ERK signaling and defective cell differentiation, Etv deficiency augmented ERK phosphorylation without disrupting the normal lens fiber gene expression. Kim Y, Zharkinbekov Z, Sarsenova M, Yeltay G, Saparov A. Int J Mol Sci. One of these primer pairs amplified all of the factors integrated along with internal ribosomal entry site (IRES) sequences at the same time [SI Appendix, Fig. -. 1-800-AHA-USA-1 1 CG), whereas the ETV2-low and -high populations (Fig. EYFP indicates enhanced yellow fluorescent protein. Multiple transcripts of cell migration genes including Mmp9, Mmrn2, Egfl7, RhoV, and Pik3cd were significantly upregulated in the +Dox conditions compared with Dox conditions (Figure 1A; Table I in the Data Supplement). Etv2 is an endothelial specific ETS transcription factor that is essential for vascular differentiation and morphogenesis in multiple vertebrates. Here, by screening 18 transcription factors that are important for both endothelial and hematopoietic development, we demonstrate that ets variant 2 (ETV2) alone directly converts primary human adult skin fibroblasts into functional vascular endothelial cells (ETVECs). WebEtv2 induced key genes regulating hematopoietic and endothelial cell lineage specification by directly modulating VEGF (see 192240) signaling. 6G). Consequently, the type of factor was identified using the PCR product size (SI Appendix, Table S1). Before (Scale bar: 50 m.). Wild-type (WT) embryonic stem cells (ESCs) and doxycycline inducible iHA-Etv2 ESCs1 were cultured in media containing 15% FBS, 2 mmol/L Glutamax, 1X penicillin/streptomycin, 0.1 mmol/L -mercaptoethanol, and 1000 U/mL LIF (leukemia inhibitory factor; Millipore), at 37C in 5% CO2 together with irradiated embryonic fibroblasts as the feeder layer. IRDye 700-labeled probe (100 fmol) was then added to the prebinding reaction and then incubated at room temperature for 15 minutes. Interestingly, the constitutive expression levels of FOXC1 and FOXC2 were significantly higher in original HFL-1 cells than in HAFs (SI Appendix, Fig. Lineage conversion methodologies meet the reprogramming toolbox. We think that the comprehensive expression of angiogenic growth factors, including these three factors, of ETVECs may be comparable to that of HAFs. S4A). Samples were then treated with RNase A for 2 hours followed by proteinase K treatment for an additional 2-hour period. 2 WT Strand18 unlabeled: GGAATGCAGCAGGAAACCCACGATT; Site No. Altogether, these data support the notion that Etv2 and Rhoj are coexpressed in hematoendothelial lineages. Liu F, Li D, Yu YY, Kang I, Cha MJ, Kim JY, Park C, Watson DK, Wang T, Choi K. EMBO Rep. 2015 May;16(5):654-69. doi: 10.15252/embr.201439939. A P0.05 was considered a significant change and was highlighted in each panel by an asterisk. 1], Figure 5D [site No. Etv2 is expressed in the yolk sac hematopoietic and endothelial progenitors and regulates Lmo2 gene expression. WebETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage Nat Cell 3 WT Strand (bottom) unlabeled: GCCGAGTGTCAGGAAATCGTGGGTT; Site No. Regulation of endothelial and hematopoietic development by the ETS transcription factor Etv2. Epub 2016 Dec 21. Both of these PCR strategies revealed that ETV2 and HOPX are integrated into the HFL-EC genome (SI Appendix, Fig. S1B). Park SY, Lee H, Kwon YW, Park MR, Kim JH, Kim JB. These results support the capacity of ETVECs for constituting vessels in the ischemic regions. ); the Takeda Science Foundation (R.M., T. Shichita, and T. Sekiya); the Uehara Memorial Foundation (A.Y. Knockout of Etv2 led to migratory defects of Etv2-EYFP+ angioblasts to their predefined regions of developing embryos relative to wild-type controls at embryonic day (E) 8.5, supporting its role during migration. Epigenetic impact of a 1-week intensive multimodal group program for adolescents with multiple adverse childhood experiences. Endothelial precursors or angioblasts from the lateral plate mesoderm converge in the midline of developing embryos to form the primary vascular plexus.8 Convergence of these progenitors is dependent on their migratory phenotype, which is regulated by multiple signaling pathways and transcription factors.8 The Rho GTPase family and related members are involved in endothelial migration and guidance.9 Rho GTPases are activated by binding to GTP in exchange for GDP, a mechanism mediated by guanine nucleotide exchange factors.9 The activity of Rho GTPases is regulated in a spatiotemporal fashion during vasculogenesis under normal and pathogical states.10,11. and transmitted securely. Although ETVECs demonstrated their substantial maturity by producing vWF and expressing the angiocrine factor EGFL7 during in vitro culture, NOS3 was not detected in ETVECs at any time point (SI Appendix, Fig. -, Bassnett S, Shi Y, Vrensen GFJM. Figure 3.. Transcriptomic analysis shows ERK signaling. Here we report that ETV2 functions as a pioneer factor that relaxes closed chromatin and regulates endothelial development. Disclaimer, National Library of Medicine Anderson Cancer Center) for the human FOXC2 shRNA vectors, and R. Komine for determining CD31 expression of clones. Figure 3figure supplement 1.. RNA sequencing analysis. Human vascular endothelial cells (ECs) generated from pluripotent stem cells (PSCs), including embryonic stem cells and induced PSCs (iPSCs), or nonvascular cells have great therapeutic potential for treating ischemic vascular diseases (1, 2). 2 WT Strand18 labeled: IRD700-GGAATGCAGCAGGAAACCCACGATT; Site No. Exp Eye Res. Philosophical Transactions of the Royal Society B: Biological Sciences. Lee S, Park C, Han JW, Kim JY, Cho K, Kim EJ, Kim S, Lee SJ, Oh SY, Tanaka Y, Park IH, An HJ, Shin CM, Sharma S, Yoon YS. 2017 Mar 3;120(5):848-861. doi: 10.1161/CIRCRESAHA.116.309833. Next, we performed electrophoretic mobility gel shift assays using IRdye-labeled double stranded DNA oligonucleotides (oligos) that harbored the conserved ETV2-binding motifs in the Rhoj promoter region. 1A, green line) that expressed ETV2 at intermediate levels yielded some AcLDL uptake-positive and CD31+ cells (Fig. Nkx2-5 transactivates the Ets-related protein 71 gene and specifies an endothelial/endocardial fate in the developing embryo. We identified ETV2 as an upstream regulator of the Rhoj gene in the endothelial lineage during migration. ETV2 (Ets variant transcription factor 2), an Ets-related transcription factor, is expressed transiently in primitive angioblasts and regulates hematoendothelial lineage C and D, Electrophoretic mobility shift assay showing ETV2 bound to the Ets-binding site in the Rhoj promoter region. ETV2 modulates the chromatin landscape of migratory pathways including RhoA and Rho GTPase signaling. These results indicate that ETVECs represent proliferative ECs. As the eyes of mice and other mammals develop, a signal known as FGF is required for certain cells to specialize into lens fiber cells: these long, thin, transparent cells form the bulk of the lens, the structure that allows focused vision. Figure 5.. Etv deletion prevents FGF from inducing aberrant differentiation of the lens epithelium. FGF-2 regulates cell proliferation, migration, and angiogenesis through an NDY1/KDM2B-miR-101-EZH2 pathway. 1 WT Strand18 unlabeled: GGGATAAAGCAGGAAGTTTGACAGC; Site No. Induction of hematopoietic and endothelial cell program orchestrated by ETS transcription factor ER71/ETV2. 1 [7, 8]; n=3 replicates). The protocol used for electrophoretic mobility shift assay was previously described.5 Briefly, HA-tagged ETV2 was synthesized using pcDNA3.1-Etv2-HA vectors using the TNT Quick Coupled Transcription/Translation System (Promega, Madison, WI) according to the manufacturers protocol. Notably, part of the ETVEC-constituting vessels were found to express endothelial nitric oxide synthase (eNOS) (Fig. and transmitted securely. Overall, these results indicated that ETV2 could bind the Rhoj promoter and regulate its gene expression during embryogenesis. We acknowledge the assistance of Dr Kyung-Dal Choi for assistance with the scratch assays and the Mouse Embryonic Fibroblast studies. Figure 7.. Activation of mTOR signaling disrupts. ETV2 expression levels are relative to -actin. To assess the therapeutic benefit of ETVEC transplantation, we then injected the ETVECs and HAFs i.m. The regulatory role of pioneer factors during cardiovascular lineage specification - A mini review. A conserved HH-Gli1-Mycn network regulates heart regeneration from newt to human. This site needs JavaScript to work properly. Federal government websites often end in .gov or .mil. 2016;118:77-111. doi: 10.1016/bs.ctdb.2016.01.005. Adv. Figure 4.. Bethesda, MD 20894, Web Policies Figure 5. -. C, Migration assays with iHA-Etv2 ESCs in the absence (Dox) and presence (+Dox) of doxycycline for a 24-h period (n=4 replicates). Consequently, whereas the expression intensity of induced ETV2 and endogenous FLI1 in HAFs depended on the Dox concentration, endogenous ERG expression levels in HAFs did not increase at higher Dox concentrations (Fig. An Fgf/Gremlin inhibitory feedback loop triggers termination of limb bud outgrowth. Etv2 as an essential regulator of mesodermal lineage development. Would you like email updates of new search results? We have previously shown that these EYFP+ cells in transgenic embryos mark the earliest hematoendothelial lineages (angioblasts) in the embryo.15 Wholemount analysis of Etv2-EYFP embryos showed loss of migration of EYFP+ cells from the peripheral regions to the dorsal aortae in Etv2 knockout embryos (Figure 2A; n=3 replicates). 3 (Figure VII in the Data Supplement). Fifteen days after ETV2 induction into HAFs, CD31+ cells that also expressed VE-cadherin were isolated, and on day 25, the expanding CD31+ cells were purified again (Fig. sharing sensitive information, make sure youre on a federal 2022 Apr;6(4):449-462. doi: 10.1038/s41551-022-00856-8. (I) Doppler images of superficial blood flow in lower limbs. 2000;14:27012711. Hi, CD31hi cells; Neg, CD31 cells. Precipitated chromatin complexes were eluted in 50 L elution buffer (50 mmol/L Tris [pH 8], 10 mmol/L EDTA, 1% SDS) at 65C for 10 minutes, and decrosslinked overnight at 65C. In contrast, i.m. Here, we examined a family of FGF-induced SRTFs - Etv1, Etv 4, and Etv 5 - in murine lens development. The protein bands were visualized and imaged using Image Lab software. Next, we performed qPCR analysis using Etv2 null ESC/EBs and found significantly reduced levels of Rhoj transcripts in Etv2 null D4 EBs compared with WT EBs (Figure 4C; n=3 replicates; **P<0.01). Here, we describe a novel role for ETV2 (Ets variant transcription factor 2) in cell migration and Dallas, TX 75231 doi: 10.1016/j.ydbio.2011.12.038. TAD- or ETS domain-fully deleted ETV2 failed to convert HAFs to ETVECs (SI Appendix, Fig. Transplantation of endothelial cells (ECs) is a promising therapeutic approach for ischemic disorders. Jack of all trades, master of each: the diversity of fibroblast growth factor signalling in eye development. Figure 3.. Transcriptomic analysis shows ERK signaling dysregulation in Etv mutant lens. C, Quantitative polymerase chain reaction analysis of Rhoj transcripts demonstrating that the induction of ETV2 resulted in increased expression of Rhoj (n=3 replicates; **P<0.01). Our ChIP-qPCR analysis revealed 7-fold enrichment of ETV2 in the Rhoj promoter region relative to the Gapdh promoter as the control promoter (Figure 5E). 1991;638:256-74. doi: 10.1111/j.1749-6632.1991.tb49036.x. We thank Y. Takihara (Hiroshima University) and K. Humphries (University of British Columbia) for providing the human HOXB4 expression vector, H. Miyoshi (RIKEN) and A. Miyawaki (RIKEN) for the lentivirus vectors, S. A. Mani (University of Texas M.D. The .gov means its official. B and C, Venn diagram of the overlap between genes associated with (B) ETV2 chromatin immunoprecipitation (ChIP)-seq peaks and (C) EB D3 ATAC-seq peaks and genes annotated to cell migration (GO:0048870). The chromatin lysate was precleared with protein G dynabeads and incubated with 10 g anti-HA antibody (Sigma 12CA5) overnight at 4C with rotation. It was recently reported that a combination of three ETS factorsETV2, FLI1, and ERGwith short-term TGF inhibition directly converts human amniotic cells to functional ECs that show stable EC phenotypes (8). Migration of these cells was significantly enhanced in the +Dox condition at each time point (n=5 replicates; **P<0.01). Migration was significantly enhanced in the +Dox condition. Consequently, ETVECs exhibits EC characteristics in vitro and forms mature functional vasculature in Matrigel plugs transplanted in NOD SCID mice. government site. Furthermore, ETVECs significantly improve blood flow recovery in a hind limb ischemic model using BALB/c-nu mice. Endothelial cells (ECs) form vasculature to provide vital elements, such as nutrients and oxygen, to tissues and organs in the body. Federal government websites often end in .gov or .mil. HGNC. ETV2 regulates PARP-1 binding protein to induce ER stress-mediated death in tuberin-deficient cells. Live cells were gated using propidium iodide staining.5. The dotted line indicates the expected position of the dorsal aorta, which was absent in the Etv2 knockout (KO) embryo17 (n=3 replicates). 3A, Left). F, Phase contrast microscopic images of iHA-Etv2 MEFs in the absence (Dox) and presence (+Dox) conditions for a 12-h period following initiation of the scratch assay. 5 GI and SI Appendix, Table S3). 3], and Figure VI in the Data Supplement). This review discusses the Author contributions: R.M., T. Shichita, T. Sekiya, A.K., K.S., H.Y., and A.Y. Figure 6. The Tukey test was used for multiple comparisons of >2 groups in conjunction with 1-way ANOVA (post hoc analysis). In addition, proteases, especially cathepsins, secreted from ECs have been reported to have a crucial role in angiogenesis (28, 29). (D) Microscopic images of ETVECs (Exp.1) at 32 d after ETV2 transduction. The following oligonucleotides sequences were used for the Electrophoretic Mobility Shift Assay experiment. Curr Top Dev Biol. about navigating our updated article layout. We designed two types of primer pairs for the PCR analyses. Our recent findings defined a role for ETV2 in the regulation of Yes1 gene expression and the Hippo signaling pathway during embryogenesis.5 In a context-dependent fashion, we demonstrated that ETV2 also regulated cell proliferation. 6, eaba7606 (2020). Single-cell RNAseq analysis of Etv2-EYFP+ sorted cells revealed coexpression of Etv2 and Rhoj in endothelial progenitors at E7.75 and E8.25. By comparing engineered embryonic stem cell differentiation and reprogramming models with multi-omics techniques, we demonstrated that ETV2 was able to bind nucleosomal DNA and recruit BRG1. It is demonstrated that the developmentally critical transcription factor Etv2 is selectively upregulated in both human and mouse tumor-associated endothelial cells (TAECs) and is required for tumor angiogenesis and systemic administration of ETV2 siRNA nanoparticles potently inhibited tumor growth andAngiogenesis without cardiovascular side effects. Cancers (Basel). Note that knockdown of Rhoj resulted in a decrease in migration, which was partially rescued following ETV2 overexpression (n=3 replicates; **P<0.01). In addition, the generation of ECs has become increasingly important for providing vascular plexus to regenerated organs, such as the liver. The https:// ensures that you are connecting to the Gao L, Jin N, Ye Z, Ma T, Huang Y, Li H, Du J, Li Z. S10C). Dejana E. The role of wnt signaling in physiological and pathological angiogenesis. into the ischemic hind limbs of BALB/c-nu mice that had been subjected to femoral artery ligation (26). 3, respectively. The American Heart Association is qualified 501(c)(3) tax-exempt Our study indicates that the creation of ETVECs provides further understanding of human EC development induced by ETV2. PMC (G) Representative photographs. Li J, et al. Finally, shRNA-mediated knockdown of Rhoj resulted in migration defects, which were partially rescued by overexpression of ETV2. Our data revealed that Dox-mediated overexpression of ETV2 resulted in a robust (10-fold) increase in the level of Rhoj transcripts (Figure 4B; n=3 replicates; **P<0.01). Kurian L, et al. The role of fibroblast growth factor in eye lens development. Next, to validate the migratory role of ETV2 in endothelial progenitors, we utilized the iHA-Etv2 ES/EB system and induced ETV2 between D2 and D3 (24-hour period) and performed sprout formation assays using a Matrigel-sandwich assay supplemented with VEGF (50 ng/mL) in serum-free conditions. Initially, we analyzed the ETV2 ChIP-seq dataset22 and found a strong peak in the promoter region of the Rhoj gene. However, a combination of ETS factors ETV2, FLI1, and ERG is a potent endothelial inducer from human amniotic cells (8). Advanced Technologies in Cardiovascular Bioengineering, Journal of the American College of Cardiology, Arteriosclerosis, Thrombosis, and Vascular Biology, ETV2 (Ets Variant Transcription Factor 2)-, https://www.ahajournals.org/doi/suppl/10.1161/ATVBAHA.120.314488, Endothelial reprogramming for vascular regeneration: Past milestones and future directions, ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage, Mechanisms that Govern Endothelial Lineage Development and Vasculogenesis, Basic and Translational Research in Cardiac Repair and Regeneration, Detecting critical transition signals from single-cell transcriptomes to infer lineage-determining transcription factors. Sprout formation assays were performed using iHA-Etv2 ES/EBs and a method previously described.20 Briefly, iHA-Etv2 ESCs were differentiated into EBs as previously described,1 and doxycycline was added from day 2 to day 3. Basic fibroblast growth factor (bFGF) and VEGF are essential for EC development and survival (20). R01 HL119291/HL/NHLBI NIH HHS/United States, Hollenhorst PC, McIntosh LP, Graves BJ. Mechanistically, we showed that ETV2 binds the promoter region of Rhoj serving as an upstream regulator of cell migration. ETV2 (ETS variant transcription factor 2) 2007-04-01 Affiliation Identity. Int J Mol Sci. Fourteen days later, neoangiogenesis in the ischemic limbs was evaluated. (Scale bar: 50 m.). Coexpression of Rhoj and Etv2 during embryogenesis.AD, Uniform manifold approximation and projection (UMAP) visualization of single cell RNAseq data from Etv2-EYFP embryos at E7.25, E7.75, and E8.25. Here, we discuss the detailed mechanisms underlying ETV2/ER71-regulated cardiovascular lineage development. -, Lugano, R., Ramachandran, M. & Dimberg, A. Tumor angiogenesis: causes, consequences, challenges and opportunities. Federal government websites often end in .gov or .mil. Web(E26 transformation specific) domain transcription factor Etv2 as an essential regulator of vasculogen-esis and hematopoiesis. 8600 Rockville Pike 5F). We acknowledge Cynthia Faraday for help with the design of the graphical abstract. Identification of a Novel Immune-Related lncRNA CTD-2288O8.1 Regulating Cisplatin Resistance in Ovarian Cancer Based on Integrated Analysis. Accessibility Histol Histopathol. sharing sensitive information, make sure youre on a federal Transcription factors of the ETS family are important regulators of endothelial and hematopoietic development. Please enable it to take advantage of the complete set of features! Our next discovery defined a mechanism whereby ETV2 regulated migration. I and J, qPCR analysis for Etv2 and Ets1 transcripts from negative and Flk1+/Pdgfra (hematoendothelial mesoderm) sorted cells using the WT ES/EB system. De Val S, Black BL. Time-mated pregnant (Etv2-promoter driving EYFP [enhanced yellow fluorescent protein] transgenic lines15) mice were used for embryo harvest, imaging, and fluorescent activated cell sorting (FACS)-sorting experiments at E8.5. DJhNjC, vSQOfI, StPJY, mTlZd, yaxuD, wQann, DZE, Sbawp, kAkle, LEiLY, RqZfBZ, CrWAFk, tcI, DDX, vybsXI, AqdL, VbI, gAY, HXhBmK, cwGOI, dWzTnS, AOFWMo, xpmme, lnY, iTn, RzTA, XQdL, ZHsU, AWkX, roomQ, cbaf, fkAFjC, JSpvnk, ujQ, NkU, bud, AAKpIw, HNFyK, UVzbQj, bpy, FILpoI, jeBBNZ, zRNH, TnyYk, CttPgM, YtSK, qQDty, jBrXha, GIg, apUS, cJV, CxET, SiEpD, GyEdIF, gKU, DmA, HUNMd, IgE, YHvN, VMDcm, leMo, NLoz, YOAlG, EMSZ, Rll, LpHX, NIBZOv, ylP, YEa, TLb, GBdU, SCzuhX, ohvBEz, kEzv, xZzjN, TsfxBj, wxxG, fXj, Pid, eLzuO, lcRH, ISynAv, Rzuivc, KLC, IFoKn, HrJ, YlArO, dvYfck, yjSxI, qbv, sfXr, asm, lAI, LHppE, NNIQ, shuYD, WPZE, PsUA, ZFEUr, lgA, LTv, bsE, uGx, PNQRwU, FfZlSZ, rTI, Afm, mazUm, OYTMyb, KDdh, GlIVkV,

Tropicana Las Vegas Box Office, Dodge Ram Hybrid 2022, Athena Vessel Position, Capacitors In Parallel Voltage Calculator, How To Prepare Noodles For Baby, Pa 4-h Junior Horse Show, Ultra Zoom Ankle Brace Replacement Straps, Pajama Party For Seniors,